cd274 promoter  (Addgene inc)

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 upregulates expression of PD-L1 and CCL2. (A) mRNA-seq analysis of ZEB2-overexpressing SW480 cells and analysis of KEGG pathways affected by ZEB2 expression. The size of each circle represents the number of genes involved in the corresponding pathway and the color scale denotes the P-value (upper). Changes in expression of cytokine-related genes in ZEB2-overexpressing SW480 cells are vs. those in control cells (lower). (B) RT-qPCR of CCL2 , CCL28 , CXCL2 , CXCL3 , CXCL6 and CXCL12 levels in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (C) RT-qPCR of CD274 mRNA levels in ZEB2-overexpressing vs. control SW480 cells (left) and in ZEB2-suppressed vs. control SNU-398 cells (right; n=4). (D) Analysis of CCL2 and PD-L1 protein levels in ZEB2-overexpressing vs. control SW480 cells (left), in ZEB2-suppressed vs. control SNU-398 cells (middle) and in ZEB2-overexpressing vs. control PC3 cells (right). Densitometric quantification of bands on the immunoblot was performed, with β-actin or GAPDH as a loading control. (E) Reporter analysis of CD274 and CCL2 promoter activity in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (F) Flow cytometry analysis of PD-L1 expression in SW480 cells transfected with ZEB2, TWIST1, or SNAIL expression vectors (n=3). Cells treated with IFN-γ or transfected with a PD-L1 expression vector were used as positive controls. Immunoblot analysis confirmed overexpression of ZEB2 (anti-myc), TWIST1 (anti-flag) and SNAIL (anti-SNAIL). (G) ELISA to measure secreted levels of CCL2 in conditioned medium from ZEB2-suppressed vs. control SNU-398 cells (n=3). (H, I) Scatter plots of ZEB2 mRNA expression vs. CD274 (H) and CCL2 (I) mRNA expression in colorectal adenocarcinoma (data from TCGA, Firehose Legacy and TCGA, Nature 2012). Correlations were statistically analyzed using the Spearman test. Spearman's correlation coefficients and equations were automatically generated using the cBioPortal webpage tool. (J) Kaplan-Meier analysis showing the relationship between overall survival of colon cancer (CPTAC-2, Prospective, Cell 2019; n=106) and pancreatic adenocarcinoma (TCGA, Firehose Legacy; n=178) patients and expression of ZEB2 and CD274 mRNA. P-values were calculated by the log-rank test. Values represent the mean ± standard deviation. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; ELISA, enzyme-linked immunosorbent assay; TCGA, The Cancer Genome Atlas; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot, Activity Assay, Flow Cytometry, Transfection, Plasmid Preparation, Over Expression, Enzyme-linked Immunosorbent Assay, Generated, Standard Deviation, Binding Assay, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 cooperates with SP1 to promote transcription of CD274 and CCL2 by binding directly to their promoters. (A) SW480 cells were co-transfected with siRNA specific for SP1 (siSP1) and with a ZEB2 expression vector, for 48 h prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. (B) RT-qPCR of CD274 (upper) and CCL2 (lower) levels in SW480 cells co-transfected with siSP1 and the ZEB2 expression vector (n=4). (C) Mutation analysis of the SP1 site in the CD274 and CCL2 promoters. SW480 cells were transfected with reporter constructs containing SP1 site mutations and reporter activity was measured (n=4). Values represent mean ± SD. *** P<0.001, vs. vector + control siRNA; $$$ P<0.001, vs. ZEB2 + control siRNA. (D) ChIP analysis of the interaction between ZEB2 and SP1 and the CD274 and CCL2 promoters. Chromatin fragments from SNU-398 cells were immunoprecipitated by normal mouse IgG (lane 1), anti-ZEB2 (lane 2), or anti-SP1 (lane 3) and data were analyzed by semiquantitative PCR using CD274 (-181/-41) and CCL2 (-115/+25) promoter primers. The input control (1%) is shown in lane 4. Irrelevant regions (-807/-660 for CD274 and -1820/-1675 for CCL2 ) were also analyzed. ZEB2, Zinc Finger E-Box Binding Homeobox 2; si, small interfering; RT-qPCR, reverse transcription-quantitative PCR; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; ChIP, chromatin immunoprecipitation.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Binding Assay, Transfection, Expressing, Plasmid Preparation, Western Blot, Control, Quantitative RT-PCR, Mutagenesis, Construct, Activity Assay, Immunoprecipitation, Reverse Transcription, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 suppresses T cell activation by upregulating PD-L1. (A) Jurkat cells transfected with NFAT-reporter construct were co-cultured for 24 h with stable SNU-398 cells (control vs. ZEB2-suppressed cells) and luciferase activity was measured 24 h after stimulation with PMA and ionomycin (n=4). (B) IL-2 secreted by Jurkat cells co-cultured with stable SNU-398 cells was measured in an ELISA (n=3). (C) Jurkat cells were co-cultured for 24 h with stable SNU-398 cells and then stimulated for 24 h with PMA and ionomycin prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Phosphorylated proteins were normalized against the corresponding total protein values. (D) Effect of an anti-PD-1 antibody on NFAT activity in Jurkat cells co-cultured with stable SNU-398 cells (n=4). Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. $$$ P<0.001 vs. Jurkat + PMA + ionomycin. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; NFAT, Nuclear factor of activated T cells; ELISA, enzyme-linked immunosorbent assay; PMA, phorbol 12-myristate 13-acetate; p-, phosphorylated; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Activation Assay, Transfection, Construct, Cell Culture, Control, Luciferase, Activity Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Binding Assay

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 SUMOylation through PC2 is required for ZEB2 acting as a transcriptional activator and playing subsequent cellular functions. (A) SW480 cells were transfected with ZEB2WT and ZEB2_K391/866R for 48 h prior to lysis and immunoblot analysis. (B) Reporter assay of ITGA5 (integrin α5), VIM (vimentin), VEGFA , CDH1 , CD274 and CCL2 promoter activity in SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=4). (C) Invasion (representative fields at magnification, ×100), (D) survival and (E) anchorage-independent growth of SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=3). (F) SW480 cells were co-transfected with shRNA specific for CBX4 (shPC2) and with a ZEB2-expression vector, for 48 h prior to lysis and immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; SUMO, small ubiquitin-like modifier; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; sh, short hairpin; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Transfection, Lysis, Western Blot, Reporter Assay, Activity Assay, shRNA, Expressing, Plasmid Preparation, Control, Binding Assay, Ubiquitin Proteomics, Mutagenesis

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: SUMOylation of ZEB2 is required for cooperation between ZEB2 and SP1. Reporter assay to determine transcriptional activity of SP1 in SW480 cells (n=4). (A) Cells were transfected with ZEB2WT and ZEB2_K391/866R expression vectors for 48 h. (B) Cells were co-transfected with a ZEB2 expression vector and siRNA specific for CBX4 (siPC2) for 48 h. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. (C) SW480 cells transfected with ZEB2WT and ZEB2_K391/866R expression vectors were treated with cycloheximide for the indicated times prior to lysis and immunoblot analysis. (D) A cytosolic fraction and a nuclear fraction were prepared from 293E cells transfected for 48 h with ZEB2WT and ZEB2_K391/866R expression vectors. GAPDH and PARP were used as internal controls for the cytosolic and nuclear fractions, respectively. (E) Co-immunoprecipitation analysis of the interaction between ZEB2 and SP1 in 293E cells co-transfected with ZEB2 (WT vs. K391/866R) and SP1 expression vectors. (F) Kaplan-Meier analysis showing the probability of progression-free survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=588) in relation to CBX4 mRNA expression. (G) Overall survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=568) in relation to expression of ZEB2 and CBX4 mRNA. P-values were calculated using the log-rank test. SUMO, small ubiquitin-like modifier; ZEB2, Zinc Finger E-Box Binding Homeobox 2; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; TCGA, The Cancer Genome Atlas; si, small interfering; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Reporter Assay, Activity Assay, Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Immunoprecipitation, Ubiquitin Proteomics, Binding Assay, Mutagenesis

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: RORA-downregulated PD-L1 promotes cytotoxic T-cell activity in melanoma cells. A and B, Analysis of immune checkpoint genes in SK-MEL-28 and A375 cells with or without RORA overexpression (vector or RORA-ha oe). qRT-PCR ( A ) and immunoblotting and quantification ( B ) of the expression of each immune checkpoint gene. n = 3. The experiments were repeated three times. C and D, PD-L1 expression in SK-MEL-28 and A375 cells treated with the RORA agonist nobiletin ( C ) or transfected with sgRORA and sgCont under IFNγ exposure ( D ), as determined by qRT-PCR and immunoblotting analysis. n = 3. The experiments were repeated three times. E–G FACS analysis of PD-L1 membrane expression after IFNγ exposure. n = 3. Three independent experiments were performed, and data are means ± SD from one representative experiment. H, Quantification of the results of the T-cell–mediated cancer cell killing assay. SK-MEL-28 and A375 cells transfected with sgCont or sgPD-L1 in the presence or absence of a RORA agonist (nobiletin, 100 µmol/L) under IFNγ exposure conditions were subjected to crystal violet staining to determine cell viability. The SK-MEL-28 and A375 transfectant to T-cell ratios were 1:3. The relative intensities of surviving cells are shown, with the T-cell untreated control sample set to 1. n = 3. Data shown are from one representative experiment of three replicates. Statistical significance in A–D and H was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Activity Assay, Over Expression, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Expressing, Transfection, Membrane, Staining, Control, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: RORA binds to the PD-L1 promoter and inhibits its transcription in melanoma cells. A and B, Normalized analysis of CD274 promoter activity in the SK-MEL-28 and A375 cell lines. The luciferase activity of the reporters containing the indicated CD274 gene promoter regions in cells transfected with shRORA ( A ) or with RORA-ha ( B ) is expressed as the relative change compared with that in the vector- or DMSO-treated cells. n = 3. Three independent experiments were performed. C and D, Binding motifs of RORA were predicted and determined in melanoma cell lines. C, Four predicted RORA-binding motifs (sites 1, 2, 3, and 4) are shown. D, RORA binding to the CD274 promoter was determined via ChIP–RT-PCR. ChIP–RT-PCR was conducted with HA and control IgG antibodies in the SK-MEL-28 and A375 cell lines. n = 3. Three independent experiments were performed. E and F, CD274 promoter constructs containing mutations in the binding region (mutant site 4) cause RORA-binding deficiency. n = 3. Data shown are from one representative experiment of three replicates. G, Lysates of SK-MEL-28 and A375 cells with RORA-ha overexpression were immunoprecipitated with anti-HA or control IgG antibodies, and then, the precipitates were blotted with anti-HDAC3 antibody. H, The structures of the GFP-tagged deleted constructs of RORA. Melanoma cells were transfected with the deletion constructs as indicated, and whole-cell lysates were immunoprecipitated and probed by immunoblotting using anti-GFP and anti-HDAC3 antibodies. NT, N-terminus; DBD, DNA-binding domain. I, mRNA and protein analysis of PD-L1 expression in SK-MEL-28 and A375 cells transfected with sgHDAC3 and negative control gRNA (sgCont) under IFNγ exposure via qRT-PCR and immunoblotting analysis. n = 3. The experiments were repeated three times. J, mRNA and protein analysis of PD-L1 expression in SK-MEL-28 and HA375 cells stably transfected with sgCont or sgHDAC3 in the presence or absence of the RORA agonist nobiletin (100 µmol/L) after IFNγ exposure. n = 3. The experiments were repeated three times. Statistical significance in A, B, D, F, I, and J was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Activity Assay, Luciferase, Transfection, Plasmid Preparation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Control, Construct, Mutagenesis, Over Expression, Immunoprecipitation, Western Blot, Expressing, Negative Control, Quantitative RT-PCR, Stable Transfection, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: DDX3X competitively interacts with RORA and inhibits T-cell cytotoxicity. A, Coimmunoprecipitation assay was conducted with an anti-HA antibody in melanoma cells. Red arrows, specific bands. B, The specific precipitated protein DDX3X was identified by mass spectrometry. C, Correlation analysis between the expression of PD-L1 and the top eight candidate proteins interacting with RORA in our dataset. D, HEK293T cells were transfected with RORA-ha and/or DDX3X-gfp. Cell lysates were immunoprecipitated with anti-HA magnetic beads (left) or anti-GFP magnetic beads (right), and then, the precipitates were detected with anti-GFP antibody (left) or anti-HA antibody (right). E and F, SK-MEL-28 and A375 cell nuclear lysates were isolated. G, The isolated nuclear lysates were immunoprecipitated with anti-HA/control IgG (top) or anti-DDX3X/control IgG antibodies (bottom), and then, the precipitates were blotted with anti-DDX3X (top) or anti-RORA (bottom) antibodies. H and I, The structures of the GFP-tagged deletion constructs of RORA and DDX3X. Melanoma cells were transfected with the deletion constructs as indicated, and whole-cell lysates were subjected to IP and probed by immunoblotting using anti-GFP, anti-HA, and anti-DDX3X antibodies. J, Overview of the interaction between human RORA-DDX3X (left) and RORA-HDAC3 (right) and a detailed enlarged view of their interaction through multiple hydrogen bonds. The RORA-binding residues are shown in orange, and the residues in blue indicate the DDX3X- or HDAC3-binding residues. K, Nuclear lysates of SK-MEL-28 and A375 cells with or without DDX3X-gfp overexpression were immunoprecipitated with an anti-RORA antibody, and then, the precipitates were blotted with an anti-DDX3X, anti-HDAC3, or anti-RORA antibody. L and M, T-cell–mediated cancer cell killing assay results. SK-MEL-28 or A375 cells with or without DDX3X overexpression/knockout under IFNγ exposure were cocultured with T cells at a 1:3 ratio for 24 to 36 hours and subjected to crystal violet staining to determine cell viability. The relative intensities of surviving cells are shown, with the T-cell untreated control sample set to 1. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. Statistical significance in L and M was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Co-Immunoprecipitation Assay, Mass Spectrometry, Expressing, Transfection, Immunoprecipitation, Magnetic Beads, Isolation, Control, Construct, Western Blot, Binding Assay, Over Expression, Knock-Out, Staining, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: DDX3X increases PD-L1 transcription by interacting with RORA and preventing it from binding the promoter of PD-L1. A and B, PD-L1 protein and mRNA levels in SK-MEL-28 and A375 cells with DDX3X overexpression or knockout in response to IFNγ stimulation were detected by immunoblotting and qRT-PCR. n = 3. Three independent experiments were performed. C and D, FACS analysis of cell surface–PD-L1 expression in melanoma cells with or without DDX3X overexpression or knockout after IFNγ exposure. n = 3. Three independent experiments were performed, and data are means ± SD from one representative experiment. E, PD-L1 promoter activity in melanoma cells transfected with sgDDX3X, control gRNA (sgCont), vector, or DDX3X overexpression plasmid (DDX3X oe) was measured by dual-luciferase reporter assays. n = 3. F and G, Analysis of PD-L1 levels in SK-MEL-28 and A375 cells stably overexpressing DDX3X-gfp in the presence of RORA-ha overexpression or the agonist nobiletin in response to IFNγ stimulation. Immunoblotting ( F ) and qRT-PCR analysis of PD-L1 expression ( G ). n = 3. Three independent experiments were performed. H, PD-L1 promoter activity was measured in melanoma cells transfected with or without DDX3X-gfp after treatment with the RORA agonist nobiletin. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. I, Analysis of PD-L1 promoter activity in melanoma cells transfected with or without truncated plasmids containing the N-terminus 1–441 or C-terminus 441–661 of DDX3X in the absence or presence of the RORA agonist nobiletin. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. J, T-cell–mediated cancer cell killing assay. SK-MEL-28 and A375 cells with or without DDX3X overexpression under IFNγ exposure were cocultured with activated T cells for 24 hours in the presence or absence of the agonist nobiletin (100 µmol/L) and subjected to crystal violet staining to determine cell viability. The cancer cell-to-T-cell ratio was 1:3. The relative intensities of surviving cells are shown, with T-cell untreated control sample set to 1. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. K, ChIP–qRT-PCR was conducted with HA and IgG antibodies in melanoma cells transfected with or without RORA-ha and/or DDX3X. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. L, Scatterplot showing a significant positive correlation between the HDAC3, DDX3X, and RORA combined scores and PD-L1 expression. M, Kaplan‒Meier curves indicating the combined index of HDAC3, DDX3X and RORA expression and PFS time in our transcriptomic dataset. Statistical significance in B, E, G, and H–K was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Binding Assay, Over Expression, Knock-Out, Western Blot, Quantitative RT-PCR, Expressing, Activity Assay, Transfection, Control, Plasmid Preparation, Luciferase, Stable Transfection, Staining, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: A RORA agonist combined with CTLA4 blockade synergistically suppresses melanoma tumor growth in vivo . A and B, A total of 1 × 10 6 B16F10 cells were injected into the flanks of C57BL/6 mice, which were then treated with an anti-CTLA4 antibody and/or a RORA agonist (nobiletin). The tumor volumes ( A ) and summary of tumor weights ( B ) harvested after the mice were euthanized. n = 5. C, Kaplan‒Meier survival curves for each group. D–G, TILs in the tumors of each group ( n = 3) were analyzed and quantified by flow cytometry analysis. H, A schematic diagram of how RORA regulates the level of PD-L1 by interacting with HDAC3 or DDX3X and modulating antitumor T-cell immunity in melanoma. Statistical significance in A, B, F, and G was determined by a two-tailed unpaired t test. Statistical significances were determined by a two-tailed unpaired t test while comparing two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: In Vivo, Injection, Flow Cytometry, Two Tailed Test

Journal: Cancer Communications

Article Title: Metabolic landscape of head and neck squamous cell carcinoma informs a novel kynurenine/Siglec‐15 axis in immune escape

doi: 10.1002/cac2.12545

Figure Lengend Snippet: Kyn promoted CD8 + T cell dysfunction and Siglec‐15 expression in tumor cells. (A) Heatmap analysis showing classical immune checkpoint gene expression in HNSCC, grouped by Kyn levels ( n = 69). (B) Gene set enrichment analysis (GSEA) of mRNAs in the Kyn‐high group. (C) The percentage of EdU + (48 h, upper) and CFSE + (96 h, lower) cells among human primary CD8 + T cells, isolated from the peripheral blood of healthy controls using a human CD8 MicroBeads kit and measured using flow cytometry, after the indicated Kyn stimulation. (D) The percentage of PD‐1 + cells in primary CD8 + T (upper) and Jurkat cell line (lower), as measured using flow cytometry, after the indicated Kyn stimulation for 48 h. (E) Western blotting analysis of PD‐1 expression after the indicated Kyn stimulation for 48 h in Jurkat cell line with or without PHA stimulation and in primary CD8 + T cells. Representative images (left) and three experiment replicates (right) are displayed. (F) Comparative heatmap depicted differential gene expression after Kyn stimulation (200 µmol/L, 48 h) using RT‐qPCR data. (G) Kyn (100 µmol/L) and the system L inhibitor, BCH (5 mmol/L) were used as the indicated treatments to analyze the functions of Kyn on the dysfunction of primary CD8 + T cells and Jurkat cells (48 h). (H) Heatmap analysis shows classical common immune checkpoint ligand gene expression in HNSCC and adjacent normal tissues from 69 patients. (I) Analysis of SIGLEC15 expression in HNSCC stratified by high or low CD274 expression. (J) PD‐L1 and Siglec‐15 expression after treatment with the indicated Kyn concentrations for 48 h (upper) or 200 µmol/L Kyn for 0, 12, 24, and 48 h (lower) by Western blotting. (K) Nuclear expression of AhR was detected by immunofluorescence staining after 200 µmol/L Kyn stimulation for 1 h. (L) Cal27 and HN30 cell lines were treated with PBS or Kyn (200 µmol/L) and/or BAY‐218 (10 µmol/L) for 48 h, and PD‐L1 and Siglec‐15 expression was detected by Western blotting. (M) Cal27 and HN30 cell lines were treated with PBS or Kyn (200 µmol/L) and/or CH‐223191 (10 µmol/L) for 48 h, and PD‐L1 and Siglec‐15 expression was detected by Western blotting. (N) PD‐L1 and Siglec‐15 expression was detected using Western blotting after siAhR transfection for 48 h and 200 µmol/L Kyn treatment for 48 h. Data are represented as the mean ± SEM based on three independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001, ns: not significant. Abbreviations: Kyn, kynurenine; HNSCC, head and neck squamous cell carcinoma, FC, fold change; GSEA, gene set enrichment analysis; ES, enrichment score; NES, normalized enrichment score; FDR, false discovery rate; EdU, 5‐ethynyl‐2′‐deoxyuridine; CFSE, carboxyfluorescein succinimidyl ester; PD‐1, programmed cell death protein 1; PHA, polyhydroxyalkanoate; IFN‐γ, interferon‐gamma; TNF‐α, tumor necrosis factor‐alpha; RT‐qPCR, real‐time quantitative polymerase chain reaction; BCH, 2‐Aminobicyclo‐(2,2,1)‐heptane‐2‐carboxylic acid; FC, fold change; PD‐L1, programmed death‐ligand 1; DAPI, 4',6‐diamidino‐2‐phenylindole; AhR, aryl hydrocarbon receptor; MFI, mean fluorescence intensity; PBS, phosphate buffered saline; SEM, tandard error of the mean; ns, not significant.

Article Snippet: The promoter primers for SIGLEC15 and CD274 were synthesized by Sangon Biotech (Shanghai, China) and are listed in Supplementary Table .

Techniques: Expressing, Gene Expression, Isolation, Flow Cytometry, Western Blot, Quantitative RT-PCR, Immunofluorescence, Staining, Transfection, Real-time Polymerase Chain Reaction, Fluorescence, Saline

Journal: Cancer Communications

Article Title: Metabolic landscape of head and neck squamous cell carcinoma informs a novel kynurenine/Siglec‐15 axis in immune escape

doi: 10.1002/cac2.12545

Figure Lengend Snippet: Kyn induced Siglec‐15‐mediated immune escape. (A) The chromatin immunoprecipitation (ChIP)‐PCR assay was performed using an IgG or AhR antibody after treatment with 200 µmol/L Kyn for 1 h. Two primers targeting the promoter region of SIGLEC15 and CD274 mRNA were used for RT‐qPCR analysis. (B) 293T cells were co‐transfected with SIGLEC15 / CD274 promoter‐luciferase reporter PGL3 for 24 h and treated with the indicated concentration of Kyn for another 6 h, followed by an analysis of luciferase activity. (C) 293T cells were co‐transfected with SIGLEC15 / CD274 promoter‐luciferase reporter PGL3 for 24 h and treated with 200 µmol/L Kyn for the indicated time, followed by an analysis of luciferase activity. (D) 293T cells were co‐transfected with promoter‐luciferase reporter plasmids and siAhR /siScr for 24 h and treated with 200 µmol/L Kyn for 6 h. (E) SCCVII cells were transfected with lentivirus‐ SIGLEC15 , and transfection was confirmed using Western blotting analysis. (F) Vector or SIGLEC15 ‐overexpressing SCCVII cells were subcutaneously injected into C3H/He mice ( n = 5 per group). Tumor volumes were measured once every two days. (G) Tumor weights were measured after mice were euthanized. (H‐J) H&E (H), TUNEL (I), and Ki‐67 (J) staining analyses of tumor tissues in each group. (K‐P) Tumor‐infiltrating lymphocytes (TIL) harvested from xenograft tumors, and the percentages of CD3 + CD8 + (K), Ki‐67 + (L), PD‐1 + (M), IFN‐γ + (N), granzyme B + (O), and perforin + cells (P) were analyzed using flow cytometry. (Q) The percentages of CD8 + in the indicated tumors were analyzed by multiplex immunofluorescence staining. (R) The volume and Ki‐67 expression of tumor were compared in tongue orthotopic transplant models established by vector or SIGLEC15 ‐overexpressing SCCVII cells ( n = 6 mice per group). (S) PD‐1 + CD8 + T cells were compared in tongue orthotopic transplant models ( n = 6 mice per group), based on multiplex immunofluorescence staining. Three regions of interest (ROIs) in each tumor were analyzed and measured. Data are represented as mean ± SEM (A‐D, F‐G and I‐S) based on three independent experiments (A‐D). * P < 0.05, ** P < 0.01, *** P < 0.001, ns: not significant. Abbreviations: Kyn, kynurenine; ChIP, chromatin immunoprecipitation; RT‐qPCR, real‐time quantitative polymerase chain reaction; AhR, aryl hydrocarbon receptor; siScr, siScramble; H&E, hematoxylin and eosin; TUNEL, TdT‐mediated dUTP‐biotin nick end labeling; PD‐1, programmed cell death protein 1; TIL, Tumor‐infiltrating lymphocyte; IFN‐γ, interferon‐gamma; ROI, region of interest; SEM, tandard error of the mean; ns, not significant.

Article Snippet: The promoter primers for SIGLEC15 and CD274 were synthesized by Sangon Biotech (Shanghai, China) and are listed in Supplementary Table .

Techniques: Chromatin Immunoprecipitation, Quantitative RT-PCR, Transfection, Luciferase, Concentration Assay, Activity Assay, Western Blot, Plasmid Preparation, Injection, TUNEL Assay, Staining, Flow Cytometry, Multiplex Assay, Immunofluorescence, Expressing, Real-time Polymerase Chain Reaction, End Labeling

Journal: Cancer Communications

Article Title: Metabolic landscape of head and neck squamous cell carcinoma informs a novel kynurenine/Siglec‐15 axis in immune escape

doi: 10.1002/cac2.12545

Figure Lengend Snippet: Siglec‐15 specific siRNA delivered by NH 2 ‐MSN nanoparticles enhances immunotherapy efficacy in vivo. (A) Synthesis routes of NH 2 ‐MSN nanoparticles loaded with siRNA. (B) Macroscopy characterization of NH 2 ‐MSNs with siS15. (C) Transmission electron microscopy images of NH 2 ‐MSNs and NP‐siS15 with indicated ratios. (D‐E) The morphology and Zeta potential of NH 2 ‐MSNs and NP‐siS15. (F) Scanning microscopy analysis of the cellular uptake of NH 2 ‐MSNs with or without the indicated siS15‐Cy5 by SCCVII cells after in vitro treatment for 24 h. (G) Western blotting analysis confirming Siglec‐15 gene‐silencing effect by siRNA released from nanoparticles in SCCVII cells. (H) Schematic diagram of the treatment strategy in SCCVII mouse model. (I) Probability of survival analysis for each group was performed. (J) Analysis of TUNEL and Ki‐67 staining of tumor tissues in each group. (K‐L) The percentage of CD3 + CD8 + (K) and PD‐1 + cells in CTLs (L) of the indicated treatment groups. (M) Analysis of multiplex immunofluorescence staining of CD3 + (green) and CD8 + (red) were shown and quantification analysis were performed in tumor tissues ( n = 10 fields of five mice per group). (N) Schematic diagram of the anti‐PD‐L1 and NP‐siS15 combination treatment strategy in C3H/He subcutaneous tumorigenesis models. (O‐P) Tumor volume and weights were measured and analyzed in the indicated groups. Data are represented as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001, ns: not significant. Abbreviations: siS15, Siglec‐15 small interfering RNA; DAPI, 4',6‐diamidino‐2‐phenylindole; AhR, aryl hydrocarbon receptor; NP‐siS15, NH 2 ‐MSN‐si SIGLEC15 ; DAPI, 4',6‐diamidino‐2‐phenylindole; siScr, siScramble; anti‐PD‐1, anti‐programmed cell death protein 1 antibody; TUNEL, TdT‐mediated dUTP‐biotin nick end labeling; CTL, cytotoxic T lymphocyte; anti‐PD‐L1, anti‐programmed death‐ligand 1 antibody; SEM, tandard error of the mean; ns, not significant.

Article Snippet: The promoter primers for SIGLEC15 and CD274 were synthesized by Sangon Biotech (Shanghai, China) and are listed in Supplementary Table .

Techniques: In Vivo, Transmission Assay, Electron Microscopy, Zeta Potential Analyzer, Microscopy, In Vitro, Western Blot, TUNEL Assay, Staining, Multiplex Assay, Immunofluorescence, Small Interfering RNA, End Labeling

Journal: Cancer Communications

Article Title: Metabolic landscape of head and neck squamous cell carcinoma informs a novel kynurenine/Siglec‐15 axis in immune escape

doi: 10.1002/cac2.12545

Figure Lengend Snippet: Siglec‐15 expression positively correlates with CD8 + T cell exhaustion in HNSCC patients. (A) Representative images of immunohistochemical staining for AhR, Siglec‐15, and PD‐L1 on a TMA of 70 HNSCC patients. (B) The correlation between Siglec‐15 expression and AhR expression using immunoreactive score (IRS) ( n = 70). (C) Comparison of positive percentage of Siglec‐15 and PD‐L1 expression in HNSCC ( n = 70). (D) GEPIA HNSCC dataset shows SIGLEC15 expression with the corresponding survival rates ( n = 50) (E) Representative images show CD8 + PD‐1 + T cells using multiplex immunofluorescence staining in TMA ( n = 70). (F) A schematic showing the mechanism via which Kyn/AhR/Siglec‐15 signaling promotes CD8 + T cell exhaustion. Data are represented as mean ± SEM. * P < 0.05, *** P < 0.001. Abbreviations: HNSCC, head and neck squamous cell carcinoma; AhR, aryl hydrocarbon receptor; PD‐L1, programmed death‐ligand 1; TMA, tissue microarray; IRS, immunoreactive score; GEPIA, Gene Expression Profiling Interactive Analysis; TPM, transcripts per million; PD‐1, programmed cell death protein 1; DAPI, 4',6‐diamidino‐2‐phenylindole; Trp, tryptophan; IDO, indoleamine 2,3‐dioxygenase 1; Kyn, kynurenine; BCH, 2‐Aminobicyclo‐(2,2,1)‐heptane‐2‐carboxylic acid; SEM, tandard error of the mean.

Article Snippet: The promoter primers for SIGLEC15 and CD274 were synthesized by Sangon Biotech (Shanghai, China) and are listed in Supplementary Table .

Techniques: Expressing, Immunohistochemical staining, Staining, Comparison, Multiplex Assay, Immunofluorescence, Microarray, Gene Expression